1Department of Cardiovascular Medicine, Chongqing Red Cross Hospital (People’s Hospital of Jiangbei District), Chongqing City, China;
2Department of Cardiology, The Affiliated Huai’an Hospital of Xuzhou Medical University and The Second People’s Hospital of Huai’an, Huai’an City, Jiangsu Province, China
Purpose: To assess the effects of ligustrazine on the progression of hypoxia-reoxygenation (H/R), and explore the possible role of miR-211 in myocardial ischemia-reperfusion (I/R) injury and identify its potential targeting gene. Methods: The level of miR-211 in H/R-induced cells was detected by quantitative polymerase chain reaction. CCK-8, flow cytometry (FCM), and Western blot assays were performed to examine the effect of miR-211 and USP47 on the role of remifentanil against H/R injury. Bioinformatic analysis and luciferase and Western blot assays were performed to identify and verify the potential target of miR-211. CCK-8 and FCM assays were performed to detect the mechanism of ligustrazine and miR-211 in the protection of remifentanil against H/R-induced cells. Results: Ligustrazine enhanced the effect of remifentanil on H/R-induced cardiomyocytes. MiR-211 enhanced the protective effect of remifentanil against H/R injury. Down-regulation of USP47 enhanced the protective effect of remifentanil against H/R injury. Ligustrazine enhanced the protective effect of remifentanil against H/R injury through miR-211/USP47 pathway. Conclusion: Ligustrazine enhanced the protective effect of remifentanil on myocardial I/R injury by regulating miR-211/USP47 pathway.
Key words: ligustrazine, myocardial ischemia-reperfusion, remifentanil, miR-211, USP47
*Corresponding Author: Dayun Xia, Department of Cardiology, The Affiliated Huai’an Hospital of Xuzhou Medical University and The Second People’s Hospital of Huai’an, No. 62, South Huai South Road, Huaian City, Jiangsu Province 223000, China. Email: dy_xia0223@163.com
Received: 22 August 2022; Accepted: 22 September 2022; Published: 18 October 2022
© 2022 Codon Publications
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/)
Myocardial infarction (MI) is a major public health problem and one of the leading causes of death worldwide (Keshavaraz et al., 2020). There is increased serum cardiac enzyme activity and progressive electrocardiographic changes that can be complicated by arrhythmias, shock, or heart failure, which can often be life-threatening. Cerebral ischemia-reperfusion (I/R) usually refers to patients who have suffered from MI, where the use of reperfusion is equivalent to ischamic preconditioning because of multiple occlusions occurring within minutes after reperfusion. Thrombolysis, primary angioplasty, and cardiac surgery are effective treatments to restore blood flow to ischemic myocardium (Jin et al., 2020). As a disease with high mortality and morbidity, MI still lacks more effective treatments, and hence an in-depth study of its pathogenesis is urgently required (Singh et al., 2021).
Ligustrazine (Lig) is one of the main active components of Ligustrum chuanxiong, which has a variety of biological activities in the cardiovascular system (Hao et al., 2018). The possible mechanisms of ligustrazine in MI are anti-oxidant, anti-inflammatory, antiapoptotic, and improving coronary blood flow and myocardial metabolism.
Salvia miltiorrhiza and ligustrazine injection decreased the apoptotic rate of H9C2 cells by inhibiting the activation of caspase-3 and increasing the ratio of Bcl-2/Bax. Studies have shown that ligustrazine can increase the expression of Mir-211 (Hao et al., 2018). In addition, the binding site between Mir-211 and USP47 was predicted on TargetScan website.
Remifentanil, an ultra short-acting, high-potency opioid pain reliever, is widely used in surgery. Preconditioning with remifentanil (RPC) normally reduces myocardial I/R damage. In the human body, it rapidly reaches the blood-brain barrier in about 1 min, and is hydrolyzed rapidly in tissues and blood (Yin et al., 2021). Therefore, it has a rapid onset and a short maintenance time, in marked contrast to other fentanyl analogs (Aoki et al., 2021). The analgesic effect of remifentanil and its adverse effects are dose-dependent and synergistic when combined with hypnotics, inhaled anesthetics, and benzodiazepines. Remifentanil has shown good therapeutic effects in a variety of cardiovascular diseases.
MicroRNAs (miRNAs) are distinguished as key regulators in the occurrence and progression of various cardiovascular diseases, such as cardiac hypertrophy, coronary atherosclerosis, and acute MI (Liu et al., 2021). Therefore, many studies have suggested that miRNAs play a prominent role in myocardial functioning (e.g., contraction and morphogenesis) and are involved in the progression of myocardial I/R injury (Wang et al., 2017). Studies have shown that expression of miR-211 is decreased during cerebral I/R (Ma et al., 2020). Low expression and up-regulation of miR-211 during renal I/R inhibited hypoxiareoxygenation (H/R)-induced apoptosis and increased cell viability (Liu et al., 2020). However, its possible role in myocardial I/R injury is still unclear.
In this study, the functioning of ligustrazine and miR-211 was investigated in myocardial I/R injury. Ligustrazine could serve as a promising drug for the treatment of MI.
Embryonic rat myocardium cells H9C2 were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA) and maintained in Dulbecco’s Modified Eagle’s Minimal Essential Medium (DMEM) mixed with 10% fetal bovine serum (FBS; Invitrogen; Carlsbad, CA, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin, in a culture hood supplied with 5% CO2 at 37°C.
For the construction of I/R model, cells were cultured in serum and glucose-deficient DMEM, and maintained in an anaerobic chamber with no oxygen supply (95% N2 and 5% CO2) at 37°C for 10 h after maintaining in normal medium for 24 h. Subsequently, cell culture condition was changed to normal condition with complete medium and oxygen access for another 24 h. Cells were divided into the following groups: control, H/R, H/R+RPC, and H/ R+ligustrazine+RPC. Ligustrazine was administrated at a dose of 10 μg/mL (Baomanbio, D0188). As a pre-treatment, Remifentanil hydrochloride (Ultiva, U22B, dissolved in sterile 0.9% NaCl) was administrated at a dose of 8 ng/mL.
Total RNAs from indicated cells were isolated with Trizol reagent (Invitrogen, Shanghai, China). Then, total RNAs were used to produce cDNA with PrimeScript reverse transcription reagent kit (Takara Biotechnology Co. Ltd., Dalian, China). Quantitative PCR was performed with SYBR mixture (Takara Biotechnology). The primer sequences of miR-211 and U6 were listed as follows: miR-211: 5’-CCGGAATTCCGGTTTTACAACA CCCCATTTCACC-3’, 5’-CGCGGATCCGCGCGAGC AACAGAGTAGAACAGG-3’ and U6: 5’-GTCGTATCC AGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACAAAATATGGAAC-3’. The relative expression level was calculated by the 2−ΔΔCt method. U6 was used as an internal control.
The sequences were listed as follows: miR-211 mimic: 5’-UAACGACGAAUAACGCAAAAUGU-3’; miR-211 inhibitors: 5’-AGGCAAAGGATGACAAAGGGAA-3’. MiR-211 mimics, miR-211 inhibitors, and corresponding controls were synthesized by GenePharma (Shanghai, China). Cells were transfected using lipofectamine 3000 (Thermo Fisher Scientific, San Jose, CA, USA) for 24 h, according to the manufacturer’s protocol.
To measure cell viability, quantitative colorimetric assay was performed with CCK-8. Briefly, cells were placed into 96-well plate at a density of 6×103 cells per well and cultured for 24 h. Thereafter, cells were supplied with CCK-8 solution and incubated for 1.5 h at 37°C. Subsequently, the values of each well were determined at 450 nm by an enzyme-linked immunosorbent serologic assay (ELISA) microplate reader.
To detect cell apoptosis, cells were treated with Annexin V-FITC apoptosis detection kit (Clontech Laboratories Inc., Palo Alto, CA, USA). Cells were seeded in 6-well plates at a density of about 4×106 cells. Cells were typsinized, washed with cold phosphate-buffered saline (PBS), and harvested at 1,000 rpm. Cells were stained with Annexin V-FITC in binding buffer, cultured for 30 min, and protected from light. Then, cells were stained with propidium iodide in dark and measured by a flow cytometer (Becton-Dickinson, Franklin Lakes, NJ, USA).
Proteins were extracted with radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Jiangsu, China). Then the samples were collected and subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto polyvinylidene fluoride (PVDF) membranes, followed by blocking with 5% fat-free milk in tris-buffered saline with Tween 20 (TBST) buffer. Subsequently, membranes were conjugated with primary antibodies targeting Bax (1:1,000 dilution, Abcam, Cambridge, MA, USA), Bcl-2 (1:1,000, Cell Signaling Technology Inc., Danvers, MA, USA), cleaved-caspase3 (1:1,000 dilution; Abcam), USP47 (1:1,000 dilution, Abcam), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:10,000, ab8226; Abcam) for 2 h at room temperature. Subsequently the membranes were incubated with specific secondary antibodies at room temperature for 1 h. The blots were analyzed with ECL kit. The blots were quantified by the ImageJ 9.0 software.
For luciferase assay, cells were transfected with miR-211 inhibitors or mimics and USP47 wide-type (WT) or mutant plasmids using lipofectamine 3000 (Invitrogen, China). USP47 with 3’-UTR was amplified by PCR. The forward primer was USP47: 5’-GGCAGGACGCTCATTAGGT-3’, 5’-GCACAACATGATTCCAA-3’. To produce mutant USP47, the mutations (wild type 3’-UTR, 5’-AAAGGGA-3’; mutated, 3’-UTR: 5’-AAATTC-3’) was incorporated with QuikChange II XL site-directed mutagenesis kit (Stratagene, Santa Clara, CA, USA). Each well was transfected with 0.2 μg of luciferase reporter plasmids and 2.5 ng of SV-Renilla luciferase plasmids. Cells were harvested and lysed and subjected to luciferase activity detection with Dual Luciferase Reporter assay kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Firefly luciferase activities were normalized to Renilla luciferase activity.
Data were shown as mean ± standard deviation (SD). For statistical analysis, one-way ANOVA followed by Turkey’s post hoc was performed; P < 0.05 was considered statistically significant.
H9C2 cells were subjected to ischemia and H/R treatment. To investigate the effect of ligustrazine on remifentanilpretreated H/R-injured cells, a CCK-8 assay was performed in H9C2 cells. H/R injury significantly impaired cell viability. Remifentanil treatment alone had little effect on cell viability. However, the combination of remifentanil and ligustrazine dramatically improved H/R-induced cell viability (Figure 1A). In addition, H/R injury induced severe apoptosis, as evidenced by increased proportion of apoptotic cells, and elevated expression levels of cleaved-caspase 3 and Bax (Figures 1B–D). Similarly, the combined usage of remifentanil and ligustrazine reduced cell apoptosis, as evidenced by decreased apoptotic cell proportion and reduced expression levels of cleaved-caspase 3 and Bax (Figures 1B–D). These results suggest that ligustrazine has a protective effect on remifentanil-pretreated H/R injured cells.
Figure 1. Ligustrazine enhances the effect of remifentanil on H/R-induced cardiomyocytes. (A) Cell viability in indicated groups as detected by CCK-8 assay. (B and C) Cell apoptosis in indicated groups as detected by flow cytometry. (D and E) Cell apoptosis in indicated groups as detected by Western blot analysis. Data are shown as SD. *p < 0.05, ***p < 0.001.
Level of miR-211 was detected by RT-qPCR. MiR-211 was down-regulated in H/R cells compared to control cells (Figure 2A). Level of miR-211 was monitored by transfection of miR-211 mimic. Overexpression efficiency was analyzed by RT-qPCR. As expected, transfection of miRNA mimics significantly increased the level of miR-211 (Figure 2B). To investigate the effect of miR-211 on remifentanil-pretreated H/R-injured cells, miR-211 was overexpressed in H9C2 cells. H/R injury then significantly impaired cell viability. Treatment of miR-211 or remifentanil alone had little effect on cell viability. However, the combination of remifentanil and miR-211 dramatically improved H/R-induced cell viability (Figure 2C). Furthermore, H/R injury induced severe apoptosis, as evidenced by an increased proportion of apoptotic cells, and elevated expression levels of cleaved-caspase 3 and Bax (Figures 2D–G). Similarly, the combined usage of remifentanil and miR-211 reduced apoptosis, as evidenced by a decrease in the proportion of apoptotic cell as well as a decrease in the expression levels of cleaved-caspase 3 and Bax (Figures 1D–G). These results suggest a protective role for miR-211 in remifentanil-pretreated H/R injured cells.
Figure 2. MiR-211 strengthens the effect of remifentanil on H/R-induced cardiomyocytes. (A) Expression of miR211 in H/R and control cells. (B) Transfection efficiency of miR211 overexpression. (C) Cell viability in indicated groups as detected by CCK-8 assay. (D and E) Cell apoptosis in indicated groups as detected by flow cytometry. (F and G) Cell apoptosis in indicated groups as detected by Western blot analysis. Data are shown as SD. *p < 0.05, **p < 0.01, ***p < 0.001.
To search the potential targets of miR-211, screening was performed by TargetScan (http://www.targetscan.org/vert_71/). The 3’-UTR was complementary to miR-211 according to bioinformatic analysis (Figure 3A). To verify this, a luciferase assay was performed, and it was observed that the luciferase activity of USP47 was significantly inhibited by miR-211 mimic (Figure 3B). However, mutant sequences of USP47 luciferase activity exhibited no significant difference in luciferase activity, indicating that USP47 was a target of miR-211. Consistently, transfection of miR-211 mimics reduced the expression of USP47 (Figure 3C). Taken together, these data suggested that miR-211 regulated USP47 expression.
Figure 3. MiR-211 negatively regulates USP47. (A) Bioinformatic prediction of target sequence of miR-211. (B) Luciferase assay detected the regulatory role of miR-211 in USP47 expression. (C) Effect of miR-211 mimics/inhibitor on USP47 expression. Data are shown as SD. *p < 0.05, ***p < 0.001.
To illustrate further the mechanism of miR-211 against remifentanil-induced H/R injury, cell viability was detected in cells that co-transfected with miR-211 mimics and USP47 overexpressed USP47. As previously described previously, miR-211 improved the viability of remifentanil-pretreated H/R injury cells. Moreover, USP47 counteracted the effect of miR-211 on the improvement of cell viability (Figure 4A). Cell apoptosis was examined by flow cytometry (FCM) and Western blot assays. Consistently, miR-211 improved cell apoptosis in remifentanil-pretreated H/R injury cells. In contrast, USP47 counteracted the effect of miR-211 on the improvement of cell apoptosis (Figures 4B–D). Therefore, miR-211 enhances the protective effect of remifentanil against H/R injury by negatively regulating USP47.
Figure 4. MiR-211 enhanced the protective effect of remifentanil on H/R injury by negatively regulating USP47. (A) Cell viability in indicated groups as detected by CCK-8 assay. (B and C) Cell apoptosis in indicated groups as detected by flow cytometry. (D) Cell apoptosis in indicated groups as detected by Western blot analysis. Data are shown as SD. *p < 0.05, **p < 0.01, ***p < 0.001.
To illustrate further the mechanism of ligustrazine against remifentanil-induced H/R injury, cell viability was detected in ligustrazine-treated cells that transfected with miR-211 inhibitor. As described previously, H/R treatment reduced miR-211 level and enhanced USP47 level. Ligustrazine ameliorated the effect of H/R on miR-211 and USP47. MiR-211 antagonized the effect of ligustrazine on USP47 (Figures 5A and B). Cell apoptosis was then examined by FCM and Western blot assays. Consistently, ligustrazine improved cell apoptosis in remifentanil-pretreated H/R injury cells. Inhibition of miR-211 counteracted the effect of ligustrazine on the improvement of cell apoptosis (Figure 5C). Therefore, ligustrazine enhanced the protective effect of remifentanil against H/R injury through miR-211/USP47.
Figure 5. Ligustrazine enhanced the protective efffect of remifentanil against H/R injury through miR-211/USP47. (A) Expression of miR-211 in indicated groups as detected by RT-qPCR. (B) Expression of USP47 in indicated groups as detected by Western blot analysis. (C) Cell apoptosis in indicated groups as detected by flow cytometry. Data are shown as SD. **p < 0.01, ***p < 0.001.
Myocardial infarction is the occlusion of a coronary artery and interruption in blood flow, resulting in localized necrosis of part of the myocardium because of severe and persistent ischemia. Its treatment mainly includes thrombolysis, surgery, etc. Reperfusion can cause damage to the myocardium, including inflammation, apoptosis, oxidative stress injury, and calcium overload (Kuramoto et al., 2021). Therefore, it is necessary to further elucidate the mechanisms and develop effective drugs for the treatment of MI. During the rescue and treatment of ischemic disease, medical scientists have come to realize that the main factor causing tissue damage is not ischemia itself but excessive free radicals attacking the cells in this part of the tissue, which is I/R injury, where the blood supply has been restored. Treatment of cerebral I/R injury is mainly through cerebral protective drugs, such as edaravone, butylphthalide, etc., which reduce damage to the brain caused by calcium overload and excessive oxygen-free radicals. Remifentanil is a commonly used drug in the treatment of MI, but its therapeutic effects require further research (Karacsonyi et al., 2021). Previous studies have confirmed that ligustrazine can improve cerebral circulation. Ligustrazine has a protective effect against cerebral I/R-induced brain injury, alleviates neuronal and microvascular endothelial cell damage and improves neurological signs, provides short-term improvement in complete cerebral ischemia, and to some extent promotes cerebral resuscitation.
MiRNAs are recognized as key regulators in the occur-rence and progression of several cardiovascular diseases, such as cardiac hypertrophy, coronary atherosclerosis, and acute MI (Chen et al., 2020). Therefore, many studies have suggested that miRNAs play a key role in myocar-dial functioning (e.g., contraction and morphogenesis) and are involved in the progression of myocardial I/R injury (Song et al., 2021). The expression of miR-211 was decreased during cerebral I/R, and it could protect cerebral I/R injury by inhibiting apoptosis (Pan et al., 2021).
Low expression and up-regulation of miR-211 during renal I/R inhibited H/R-induced apoptosis and increased cell viability. As shown in CCK-8 and FCM assays, miR-211 enhanced the protective effect of remifentanil against H/R injury through USP47.
In this study, a novel function of miR-211 was identified in the progression of MI. Indeed, the possible roles of miR-211 in different cellular processes are revealed broadly. Knockdown of nuclear-enriched abundant transcript 1 (NEAT1), a long non-coding RNA (lncRNA), could relieve inflammatory response to spinal cord injury through targeting miR-211. In addition, the neuroprotective effects of miRNA-211 on chronic stress-induced neuronal apoptosis have been reported. Hippocampal miR-211 could mediate neurogenesis and depression-like behaviors in mice (Li et al., 2021). MiR-211 also regulates TAB1 expression and inhibits the nuclear factor kappa B (NF-κB) pathway in lipopolysaccharide-induced endometritis. These studies, together with these findings, confirmed that miR-211 could act as a promising target for the treatment of multiple diseases.
USP47, a member of the ubiquitin-specific protease (USP) family, was reported to be increased in rat H9C2 cardiomyocytes in an I/R injury model. USP47 knockdown reduced I/R injury-induced apoptosis (Thogersen et al., 2021). Interestingly, in this study, miR-211 enhanced the protective effect of remifentanil on myocardial I/R injury by suppressing the expression of USP47. Targeting USP47 could overcome resistance to tyrosine kinase inhibitor and further eradicate stem cells in leukemia (Thogersen et al., 2021). According to these data, USP47 could serve as a promising target for MI treatment.
To illustrate further the mechanism of ligustrazine on remifentanil-induced H/R injury, cell viability was assayed in ligustrazine-treated cells that transfected with miR-211 inhibitor. Interestingly, it is found that ligustrazine enhanced the protective effect of remifentanil against H/R injury through miR-211/USP47. Studies have demonstrated that ligustrazine could increase the expression of miR-211, although this mechanism requires further investigation. One of the limitations of this study was that molecular mechanism was not studied and verified; this requires to be confirmed in the future studies.
Ligustrazine enhances the protective effect of remifentanil on myocardial I/R injury by regulating miR-211/USP47 pathway. Therefore, ligustrazine could serve as a promising drug for the treatment of myocardial I/R injury.
Aoki, Y., Niwa, T., Shiko, Y., Kawasaki, Y., Mimuro, S., Doi, M. and Nakajima, Y., 2021. Remifentanil provides an increased proportion of time under light sedation than fentanyl when combined with dexmedetomidine for mechanical ventilation. Journal of International Medical Research 49: 3000605211002683. 10.1177/03000605211002683
Chen, K., Zhao, Z., Wang, G., Zou, J., Yu, X., Zhang, D., Zeng, G. and Tang, C., 2020. Interleukin-5 promotes ATP-binding cassette transporter A1 expression through miR-211/JAK2/STAT3 pathways in THP-1-dervied macrophages. Acta Biochimica et Biophysica Sinica (Shanghai) 52 832–841. 10.1093/abbs/gmaa071
Hao, M.H., Zhang, F., Liu, X.X., Zhang, F., Wang, L.J., Xu, S.J., Zhang, J.H., Ji, H.L. and Xu, P., 2018. Qualitative and quantitative analysis of catechin and quercetin in flavonoids extracted from Rosa roxburghii Tratt. Tropical Journal of Pharmaceutical Research 17: 71–76. 10.4314/tjpr.v17i1.11
Jin, B., Dong, W., Sun, D., Cai, B. and Wu, P., 2020. Yangjing capsule attenuates cyclophosphamide-induced deficiency of testicular microcirculation in mice. Tropical Journal of Pharmaceutical Research 19: 603–608.
Karacsonyi, J., Schmidt, C.W., Okeson, B.K., Garcia, S., Henry, T.D., Nikolakopoulos, I., Vemmou, E., Xenogiannis, I., Sharkey, S., Aguirre, F.V., Tannenbaum, M., Nicholas Burke, M., Goessl, M., Sorajja, P., Traverse, J., Wang, Y.L. and Brilakis, E.S., 2021. Comparison of outcomes of patients with vs without previous coronary artery bypass graft surgery presenting with ST-segment elevation acute myocardial infarction. American Journal of Cardiology 154: 33–40. 10.1016/j.amjcard.2021.05.041
Keshavaraz, N., Naderifar, M., Firouzkohi, M., Abdollahi Mohammad, A. and Akbarizadeh, M.R., 2020. Effect of telenursing on the self-efficacy of patients with myocardial infarction: a quasi-experimental study. Signa Vitae 16: 92–96.
Kuramoto, M., Okada, M., Saeki, H., Yoshida, Y. and Hasegawa, S., 2021. Acute myocardial infarction due to coronary occlusion caused by a metastatic cardiac tumor arising from squamous cell lung cancer: an evaluation with three-dimensional transthoracic echocardiography. Internal Medicine 61(3): 345–350. 10.2169/internalmedicine.7580-21
Li, Y., Fan, C., Gao, R., Lan, T., Wang, W. and Yu, S.Y., 2021. Hippocampal miR-211-5p regulates neurogenesis and depression-like behaviors in the rat. Neuropharmacology 194: 108618. 10.1016/j.neuropharm.2021.108618
Liu, F., Guo, J., Qiao, Y., Pan, S., Duan, J., Liu, D. and Liu, Z., 2021. MiR-138 plays an important role in diabetic nephropathy through SIRT1-p38-TTP regulatory axis. Journal of Cellular Physiology 236(9): 6607–6618. 10.1002/jcp.30238
Liu, W., Miao, Y., Zhang, L., Xu, X. and Luan, Q., 2020. MiR-211 protects cerebral ischemia/reperfusion injury by inhibiting cell apoptosis. Bioengineered 11: 189–200. 10.1080/21655979.2020.1729322
Ma, N.H., Zhang, M.H., Yang, J.X., Sun, Z.J., Yuan, F. and Qiu, X.L., 2020. Long noncoding RNA HOTAIR sponging miR-211 regulates cerebral ischemia-reperfusion injury. Journal of Biological Regulators and Homeostatic Agents 34: 2209–2214. 10.23812/20-287-L
Pan, J.K., Lin, C.H., Kuo, Y.L., Ger, L.P., Cheng, H.C., Yao, Y.C., Hsiao, M. and Lu, P.J., 2021. MiR-211 determines brain metastasis specificity through SOX11/NGN2 axis in triple-negative breast cancer. Oncogene 40: 1737–1751. 10.1038/s41388-021-01654-3
Singh, A., Dwivedi, S., Pradhan, A., Narain, V.S., Sethi, R., Chandra, S., Vishwakarma, P., Chaudhary, G., Bhandari, M. and Sharma, A., 2021. Isolated ST-elevation myocardial infarction involving leads I and aVL: angiographic and electrocardiographic correlations from a tertiary care center. Cardiology Research and Practice 2021: 7638020. 10.1155/2021/7638020
Song, N., Luo, J., Huang, L., Tian, H., Chen, Y. and He, Q., 2021. miR-204-5p and miR-211 synergistically downregulate the alpha S1-casein content and contribute to the lower allergy of goat milk. Journal of Agricultural and Food Chemistry 69: 5353–5362. 10.1021/acs.jafc.1c01147
Thogersen, M., Frydland, M., Lerche Helgestad, O.K., Okkels Jensen, L., Josiassen, J., Goetze, J.P., Moller, J.E. and Hassager, C., 2021. Admission biomarkers among patients with acute myocar-dial-infarction related cardiogenic shock with or without out-of-hospital cardiac arrest An exploratory study. Biomarkers 26(7): 632–638. 10.1080/1354750X.2021.1955975
Wang, B., He, P.P., Zeng, G.F., Zhang, T. and Ou Yang, X.P., 2017. miR-467b regulates the cholesterol ester formation via targeting ACAT1 gene in RAW 264.7 macrophages. Biochimie 132: 38–44. 10.1016/j.biochi.2016.09.012
Yin, H., Cao, L., Zhao, H. and Yang, Y., 2021. Effects of dexmedetomide, propofol and remifentanil on perioperative inflammatory response and lung function during lung cancer surgery. American Journal of Translational Research 13: 2537–2545. PMid: 34017412.