1Key Laboratory of Biomarker Based Rapid-detection Technology for Food Safety of Henan Province, Food and Pharmacy College, Xuchang University, Xuchang, China;
2School of Food and Biological Engineering, Henan University of Science and Technology, Kaiyuan Avenue, Luoyang, China;
3Xuchang Pangdonglai Supermarket Co., Ltd., Xuchang, Henan, China;
4Zhoukou Market Supervision Coordinated Administrative Law Enforcement Detachment, Zhoukou, Henan, China;
5Yuzhou Houshengtang Traditional Chinese Medicine Co., Ltd., Yuzhou, Henan China
For rapid detection of wheat components in starch products, this study developed the analysis method based on the ladder-shape melting temperature isothermal amplification (LMTIA) coupled with proofreading enzyme-mediated probe cleavage (Proofman). With the internal transcribed spacer (ITS) gene of Triticum aestivum L. (wheat) as the target, specific primers and the Proofman probe were designed, the reaction temperature was optimized, and the sensitivity and the specificity of the Proofman-LMTIA method were determined. With the results indicating that the optimal reaction temperature of this Proofman-LMTIA method was 65°C, it can specifically detect wheat components rather than seven other species; the sensitivity was 10 fg (femtograms) of the genomic deoxyribonucleic acids (gDNAs) of Triticum aestivum L. and the detection limit was 0.1% of the artificially adulterated wheat starch. The Proofman-LMTIA reaction could be completed in 20 minutes, and 1 of 12 commercial starch products was found to have adulterated wheat starch. In conclusion, the established Proofman-LMTIA method was suitable, or rapid and accurate, for the detection of wheat components in starch products.
Key words: wheat starch, Proofman probe, ladder-shape melting temperature isothermal amplification
*Corresponding Authors: Deguo Wang, PhD, Key Laboratory of Biomarker Based Rapid-detection Technology for Food Safety of Henan Province, Food and Pharmacy College, Xuchang University, Xuchang, China. Email: wangdg666@126.com; Yao Wang, School of Food and Biological Engineering, Henan University of Science and Technology, Kaiyuan Avenue, Luoyang, China. Email: wangyao@haust.edu.cn
Academic Editor: Charles Okpala, PhD, UGA Cooperative Extension, University of Georgia, Athens, GA 30602, United States
Received: 19 October 2024; Accepted: 3 March 2025; Published: 11 April 2025
© 2025 Codon Publications
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/)
As the most extensively cultivated crop globally (Luo et al., 2023), wheat (Triticum aestivum L.), a crop of the grass family, is known for its remarkable adaptability (Guo et al., 2024) that serves as the staple food for around 35% of the world’s population. More than two-thirds of the wheat has been processed into a variety of food products for humans (Ulrike et al., 2021). Twenty percent of the human body’s daily requirement for energy and protein were provided by wheat (Peter et al., 2023), a product abundant in carbohydrates, proteins, dietary fiber, and a range of vitamins as well as essential minerals such as calcium and iron (Brittany et al., 2020). Due to its significant economic value and the increasing global demand, wheat-based foods have been increasingly adulterated with low-priced starches or wheat starch mixed with expensive starch products; this false labeling has become widespread (Ankara et al., 2023; He et al., 2023; Salvatore et al., 2020; Zhou et al., 2022). This adulteration not only infringes on the rights and interests of consumers but also impacts a market with a fair competition environment. Hence, implementation of stringent standards is essential where they govern the incorporation of wheat starch into high-price commercial starch products, facilitating effective monitoring of any potential adulteration.
In recent years, spectroscopy-based detection technologies have emerged as common methods for identifying the source of starch, frequently due to their elimination of sample pretreatment requirements (Ayvaz et al., 2021; Liu et al., 2023; Marquez et al., 2016; Pastor et al., 2019). However, these methodologies require specialized equipment and skilled personnel, which limit them mainly to laboratory application due to the complexity of data analysis. Another category of detection methods are based on deoxyribonucleic acid (DNA) analysis, such as polymerase chain reaction (PCR), real-time PCR, and droplet digital PCR, which are widely used for the detection of starch products due to their high specificity and sensitivity (Carloni et al., 2017; Chen et al., 2020; Caterina et al., 2021; Lüthy et al., 2001). But as these PCR-based methods require a complicated thermal cycler, a range of nucleic acid isothermal amplification techniques have been developed, such as the loop-mediated isothermal amplification (LAMP) (Notomi et al., 2000), rolling circle amplification (RCA) (Murakami et al., 2009), cross priming amplification (CPA) (Xu et al., 2012), and so on and so forth. Any of these techniques can exponentially amplify the target sequence of DNA at constant temperature. Among these techniques, LAMP stands out as a particularly promising method for biological analysis due to its simplicity, high specificity, and high sensitivity (Glökler et al., 2021); however, the technique is subject to high false positive rate (Cai et al., 2009), and the detection of wheat components in commercial starch with the LAMP method or the ladder-shape melting temperature isothermal amplification (LMTIA) method has not currently been reported. Hence the necessity to develop a simple, rapid, sensitive, and cost-effective method for starch identification.
Based on the LAMP technology, a novel method known as LMTIA was developed in 2021 (Wang et al., 2021), characterized by its rapidity, simplicity, and cost-effectiveness. Notably, the primer design is more straightforward compared to the LAMP methods, requiring only one pair of primers or two pairs of nested primers. The incidences of false positives and nonspecific amplification were significantly reduced while at the same time enhancing both sensitivity and specificity (Cui et al., 2024). The amplification time for the target sequence is only 20 minutes. In contrast to the PCR techniques, this method operates at constant temperature rather than cycling temperature; it solely relies on the Bst (Bacillus stearothermophilus) DNA polymerase to produce a single-stranded DNA template. Additionally, the reagent cost per test is less than USD 2.0. This technique was applicable across various domains, including food safety and medical diagnostics. The studies of the LMTIA technique have been reported on detection of cassava components in sweet potato (Zhang et al., 2022), identification of soybeans in edible oil samples (Gu et al., 2023), detection of African swine fever virus (Wang et al., 2022), and authentication of meat products (Wang et al., 2022). The enzymatic-mediated probe cleavage (Proofman) probes (Ding et al., 2021) are used to improve the detection speed and throughput of the LMTIA methods. The Proofman-LMTIA methods have been effectively applied to dual detection of sweet potato and corn (Cui et al., 2024), rapid discrimination of Panax quinquefolium and Panax ginseng (Zhang et al., 2023), and rapid distinguishment of Bupleurum scorzonerifolium Willd and Bupleurum chinense (Liu et al., 2024).
The Proofman-LMTIA methods (mentioned above) have been widely used in the identification of food, pathogenic bacteria, and Chinese medicinal materials. However, the detection of wheat components in commercial starch with the Proofman-LMTIA method has not currently been reported, and the objective of this study was to establish the Proofman-LMTIA method for rapid detection of wheat components in commercial starch products.
Wheat starch and lotus root starch were purchased from Pangdonglai Supermarket, Ltd. in Xuchang, Henan Province, China, and potato, pea, cassava, sweet potato, mung bean, maize, and 12 commercial starch products were purchased from Xiyunmeng Supermarket, Ltd. in Xuchang, Henan Province, China.
According to the study by Wang et al. in 2021, the target sequence selected had the ladder-shape melting temperature curves and the GC (guanine-cytosine) content ranging from 40% to 80%, and was of high specificity (Wang et al., 2021). The internal transcribed spacer (ITS) sequence of Triticum aestivum L. was obtained from the GenBank database, the target sequence was selected with the Oligo 7 software (Molecular Biology Insights, Inc. Colorado Springs, CO, USA), and the LMTIA primers and probes were designed with the online software Primer3Plus (https://www.primer3plus.com).
The purchased starch products were in powder form, the samples for specificity determination were fresh plants, and the 12 commercial samples were starch noodles. The genomic deoxyribonucleic acids (gDNAs) were extracted from wheat, sweet potato, maize, cassava, potato, lotus, pea, and green bean with the Plant Genomic DNA Extraction Kit (Beibei Biotech Co. Ltd., Zhengzhou, China). The content and purity of gDNAs were analyzed with the NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
With the extracted gDNAs, the temperature of the LMTIA reaction was optimized. The Proofman-LMTIA reaction temperature was optimized using 10 μL reaction system (Table 1). The reaction mixture was overlaid with 20 μL of liquid paraffin to avoid aerosol contamination. The diethylpyrocarbonate-treated water (DEPC H2O) (deoxyribonucleases/ribonucleases [DNase/RNase] free) was used as negative control and the gDNAs from wheat were diluted to 1 ng/μL as positive control. The reaction system was heated at 61°C, 63°C, 65°C, and 67°C in the Gentier 96E Automatic Medical Real-Time PCR Analysis System (Xian Tianlong Technology Co., LTD, Xi’an, Shanxi Province, China), (Yao et al., 2024), respectively, and the fluorescent signals were collected 40 times with 30-second intervals. The experiment was repeated twice and parallel tests conducted in each experiment.
Table 1. The Proofman-LMTIA reaction system.
| Reagents | Added amount (10 µL) |
|---|---|
| 5 × LMTIA mix | 2 µL |
| Bst | 0.40 µL |
| F (100 µM) | 0.16 µL |
| B (100 µM) | 0.16 µL |
| LF (100 µM) | 0.04 µL |
| Probe (100 µM) | 0.1 µL |
| DEPC H2O | Add to 8 µL |
| Positive control | 2 µL |
| Negative control | 2 µL |
The specificity was determined at optimized temperature. The gDNAs from wheat starch and seven other common starches, including potato, pea, cassava, sweet potato, mung bean, maize, and lotus, were used to determine the specificity of the Proofman-LMTIA method. The amounts of gDNAs templates were 2 μL (1 ng/μL) per reaction; these reaction mixtures were heated at optimized temperature for 20 minutes. The experiment was repeated twice and parallel tests conducted in each experiment.
The gDNAs extracted from Triticum aestivum L. was diluted in a 10-fold series to six gradient concentrations of 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL, and 10 fg/µL for determining the sensitivity of the Proofman-LMTIA method. The positive controls were the 1 ng/µL gDNAs of Triticum aestivum L. and the negative controls were DEPC H2O. The reaction mixtures were heated at optimized temperature for 20 minutes. The experiment was repeated twice and parallel tests conducted in each experiment.
To determine the detection limit of the Proofman-LMTIA method, wheat starch was mixed with maize starch at percentages (weight by weight [w/w]) of 20, 10, 5, 1, and 0.1, respectively. The gDNAs were extracted using the Plant Genomic DNA Extraction Kit as described in the DNA extraction. Positive controls were 1 ng/µL gDNAs of Triticum aestivum L. and negative controls were DEPC H2O. The reaction mixtures were heated at optimized temperature for 20 minutes. The experiment was repeated twice and parallel tests conducted in each experiment.
A total of 12 commercial starch products were tested for wheat components and ground into powder with a high-speed grinder. The gDNAs were extracted using the Plant Genomic DNA Extraction Kit as described in Section DNA extraction. The reaction mixtures were heated at optimized temperature for 20 minutes. The 1 ng/µL gDNAs of Triticumaestivum L. were used as positive controls, while the DEPC H2O was used as negative controls, and the gDNAs extracted from the commercial products were used as samples to be tested. The experiment was repeated twice and parallel tests conducted in each experiment.
With the ITS gene of Triticumaestivum L. as the target, the specific 75-nt (nucleotide) sequence with the ladder-shaped melting temperature curve was selected with the Oligo 7 software (Molecular Biology Insights, Inc. Colorado Springs, CO, USA) (Figure 1), and the LMTIA primers of wheat was designed with the online software Primer3Plus (https://www.primer3plus.com). Upon the loop primer forward (LF) sequence, the Proofman probe with a quencher was labeled at the end of the 5' nucleotide and a fluorophore was labeled at the end of the 3' mismatch nucleotide. The sequences of primers and probes are shown in Table 2.
Figure 1. The target sequence with the ladder-shape melting temperature curve for detection of wheat components with the Proofman-LMTIA method.
Table 2. The sequences of the primers, the Proofman probe, and the target for detection of wheat components with the Proofman-LMTIA method.
| Primers and probes | Sequence (5’ to 3’) |
|---|---|
| XM-F | 5’-AGCAAGCTAGACTTTTCGAAGGCGTCAAGGAACACT-3’ |
| XM-B | 5’-TAGCTTGCTAGCTTTTAGCTTTGCAACACGAGGGA-3’ |
| XM-LF | 5’-ATGCCCCCGGGTTAG-3’ |
| XM-LF Probe | 5’BHQ2-ATGCCCCCGGGTTAA-3’6-FAM |
| XM: Wheat | CGAAGGCGTCAAGGAACACTGCCTAACCCGGGGGCATGTCTAGCTTGCTAGCCGTCCCTCGTGTTGCAAAGCT |
The concentrations of the gDNAs extracted from wheat, sweet potato, maize, cassava, potato, lotus root, pea, mung bean, and commercial starch products were higher than 1 ng/μL, with their A260/A280 ratios falling between 1.8 and 2.0 (Table 3).
Table 3. The concentration and purity of the extracted gDNAs.
| No. | Samples | Concentration (ng/mL) |
Purity (A260/A280) |
|---|---|---|---|
| 1 | Wheat | 26 | 1.89 |
| 2 | Sweet potato | 56 | 1.95 |
| 3 | Maize | 36 | 1.89 |
| 4 | Cassava | 21.9 | 1.96 |
| 5 | Potato | 98 | 1.87 |
| 6 | Lotus | 18.6 | 1.81 |
| 7 | Pea | 36.2 | 1.89 |
| 8 | Mung bean | 57 | 1.82 |
The Proofman-LMTIA system was prepared in the PCR reaction tube; 20 μL liquid paraffin was added to avoid aerosol pollution. The Proofman-LMTIA reaction systems were heated at 61°C, 63°C, 65°C, and 67°C, repectively. The result shows that all the reactions with gDNAs of Triticum aestivum L. were positive (Ct 11.92 ± 0.30 at 61°C, Ct 11.46 ± 0.07 at 63°C, Ct 11.9 ± 0.02 at 65°C, Ct 20.29 ± 0.6 at 67°C) and all the reaction with DEPC H2O were negative; however, the amplification efficiency and the repeatability were the highest at 65°C, so the optimal temperature was 65°C (Figure 2).
Figure 2. Temperature optimization of the Proofman-LMTIA reaction for detection of wheat components. The amplification plots of Proofman-LMTIA reactions at different temperatures (61°C, 63°C, 65°C, 67°C); positive control: gDNAs of Triticum aestivum L.; negative control: DEPC H2O.
To verify the that the designed LMTIA primers and Proofman probe were specific to the gDNAs of Triticum aestivum L. at 65°C, the gDNAs from potato, pea, cassava, sweet potato, mung bean, maize, and lotus were used for determination with DEPC H2O as the negative control. The results showed that the reactions with the gDNAs of Triticum aestivum L. were tested to be positive (Ct 9.29 ± 0.12), and the reactions with the gDNAs from potato, pea, cassava, sweet potato, green bean, maize, and lotus as well as DEPC H2O had no amplification, which indicated that the established Proofman-LMTIA method was of high specificity (Figure 3).
Figure 3. The specificity determination of the Proofman-LMTIA method for detection of Triticumaestivum L. gDNA. Others included the gDNAs from potato, pea, cassava, sweet potato, green bean, maize, and lotus.
The 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL, and 10 fg/µL gDNAs of Triticum aestivum L. were used for the sensitivity determination of the established Proofman-LMTIA method. The result shows that statistical analysis for each concentration reaction system were: Ct 10.09 ± 0.02 of 1 ng/µL, Ct 11.30 ± 0.07 of 100 pg/µL, Ct 11.68 ± 0.09 of 10 pg/µL, Ct 14.78 ± 0.06 of 1 pg/µL, Ct 15.35 ± 0.21 of 100 fg/µL, and Ct 18.01 ± 0.84 of 10 fg/µL; all negative controls were negative (Figure 4). Hence, the sensitivity was 10 fg gDNAs of Triticum aestivum L., indicating that the established Proofman-LMTIA method was of high sensitivity.
Figure 4. The sensitivity of the Proofman-LMTIA method determined with serial 10-fold dilution of Triticumaestivum L. gDNA.
The gDNAs extracted from maize starch adulterated with 20%, 10%, 5%, 1%, and 0.1% (w/w) wheat starch were used for the detection limit determination, and the DEPC H2O was used at the negative controls. Statistical analysis of each adulteration ratio was: Ct 11.16 ± 0.10 of 20%, Ct 13.35 ± 0.0.07 of 10%, Ct 13.83 ± 0.25 of 5%, Ct 14.68 ± 0.0.26 of 1%, and Ct 18.97 ± 0.01 of 0.1%; all negative controls were negative (Figure 5). Consequently,the detection limit of the established Proofman-LMTIA method was 0.1%.
Figure 5. The detection limit of the Proofman-LMTIA method for detection of wheat components adulterated into the commercial starch product.
In order to validate the practical application value of the Proofman-LMTIA method, 12 commercial noodle products were tested for wheat components; the shape of these products are shown in Figure 6. The results of wheat component detection in the commercial strach products were detailedly summarized in Table 4 and Figure 6. The reactions of the positive controls, No 4 sample, and No 8 sample were wheat components positive (positive sample: Ct 9.62 ± 0.16; No 8 sample: Ct 12.24 ± 0. 23; No 4 sample: Ct 18.75 ± 1.05), whereas the reactions of the other samples and negative controls were wheat components negative. The results indicated that No 4 and No 8 samples contained wheat components, whereas the other samples did not contain any. The label of No 4 sample did not indicate any wheat components, whereas the label of No 8 sample indicated the wheat components. It was confirmed that the established Proofman-LMTIA method could effectively validate the presence of wheat components in commercial starch products, which possessed high practical value.
Table 4. The commercial starch products tested with the Proofman-LMTIA method.
| No. | Commercial samples | Labeling ingredients | Wheat |
|---|---|---|---|
| 1 | Maize starch: 1 | Maize | - - |
| 2 | Potato starch: 2 | Potato | - - |
| 3 | Sweet potato starch: 3 | Sweet potato | - - |
| 4 | Pea noodles | Pea | + + |
| 5 | Lotus starch: 1 | Lotus | - - |
| 6 | Lotus starch: 2 | Lotus | - - |
| 7 | Lotus starch: 3 | Lotus | - - |
| 8 | Noodles: 1 | Wheat | + + |
| 9 | Noodles: 2 | Pea, maize | - - |
| 10 | Noodles: 3 | Pea, mung bean | - - |
| 11 | Noodles: 4 | Sweet potato | - - |
| 12 | Noodles: 5 | Potato | - - |
Figure 6. Detection of the commercial starch products with the Proofman-LMTIA method.
Food adulteration has become an important food safety issue around the world. Economically motivated food adulteration has an impact on consumers’ right to know; it also reduces the overall quality of food. At present, the economically motivated food adulteration is common in high-value products tainted with low-value products, namely the high-price products were adulterated with the low-price products (Kaldeli et al., 2024). The identification of starch adulteration currently is a challenge (a large number of researchers had paid attention to starch authentification). Vis-NIR spectroscopic and chemometric models were used for detecting premium green banana flour contaminated with wheat different levels (Ndlovu et al., 2021). Fourier transform near-infrared and mid-infrared (FT-NIR, FT-MIR) spectroscopy and chemometric analysis were used to detect milk powder adulterated with corn starch and wheat flour (Edwin et al., 2024). Raman spectroscopy and one-class support vector machine were used to detect adulterants in cassava starch; cassava starch samples were modified with adulterants ranging from 0.5 to 50%, such as wheat flour, sodium bicarbonate, and others. This method resulted in the possibility of detecting adulterations over 2% (Cardoso et al., 2021). Schulze established the primer probe systems for real-time quantitative fluorescent PCR (real-time PCR) and droplet digital PCR (ddPCR), which were used for detection and validation of cereals such as bread wheat, durum wheat, rye, and barley. ddPCR could correctly detect proportions of 50%, 60%, and 90% wholemeal rye flour in a mixture of wholemeal common wheat flour (Schulze et al., 2021).
Although these methods have shown the capability for detection of illegal adulteration in various starch products, they have some disadvantages such as expensive equipment, complex instrument operation and data analysis, long reaction time, and many kinds of reagents used; therefore, the need to establish a simple, rapid, sensitive, and economical technology for starch product identification. The Proofman-LMTIA method has been used in many fields for rapid detection. Compared with FT-NIR, FT-MIR, Roman spectroscopy, real-time PCR, and ddPCR, the Proofman-LMTIA method is simple, and the amplification is completed in 20 minutes at constant temperature without the need for complex and precise equipment and data analysis. In this study, the Proofman-LMTIA method for detection of wheat components was etablished. When the specificity of the Proofman-LMTIA method was verified with several common starches (potato, cassava, mung bean, sweet potato, lotus root powder, and corn), the sensitivity of the Proofman-LMTIA method was 10 fg/µL gDNAs of Triticum aestivum L. and the detection limit of the Proofman-LMTIA method was as low as 0.1%.
To verify the application prospects of the Proofman-LMTIA method, we tested six commercial starch products and six noodle products from different regions. Their labels indicated that only No 8 sample contained wheat components and the other 11 samples did not contain any. However, the test results showed that No 4 sample contained wheat components, an indication of adulteration with wheat starch; the established Proofman-LMTIA method can detect such fraud.
In this study, the Proofman-LMTIA technique was found to be suitable for the detection of wheat components in commercial starch products. Beyond the application in the detection of starch products, the Proofman-LMTIA technique was also utilized for the identification of other food fraud, such as meat product (Wang et al., 2022), honey (Yao et al., 2024), and identification of Chinese medicinal materials (Zhang et al., 2023). In summary, the Proofman-LMTIA system is a sensitive, specific, quick, simple, and an economic method. The popularization of this method could effectively identify the adulteration of commercial starch, protect consumers, and contribute to food safety.
In this study,Proofman-LMTIA method has been established for rapid dection of wheat component in starch. The LMTIA primers and Proofman probe were designed for the target sequence of wheat gene with high specificity. The sensitivity of the Proofman-LMTIA assay at 10 fg/uL gDNAs of Triticum aestivum L. was proven at the optimal temperature of 65°C, where the whole amplification could be finished within 20 minutes. Additionally, the cost is very low, with the reagent cost per test being less than USD 2.0. Summarily, the Proofman-LMTIA methodology has been successfully established, notable for its rapid, simple, economic, specific, and sensitive in the detection of wheat component in starch. The popularization of this Proofman-LMTIA technique should improve the quality control of wheat component in starch products, provide guidelines for the authentication of wheat ingredients, and supervision of food market. The Proofman-LMTIA technology not only identifies wheat component in starch, but can also be used to certify the origin of a wide range of plants.
The data used to support this study’s findings are available from the corresponding author upon request.
Conceptualization: D.W. and Y.W.; methodology: D.W.; software: W.Y.; validation: D.W. and D.Z.; formal analysis, D.W. and Y.W.; investigation, C.S., B.Y., and S.G.; resources, D.W. and X.Z.; data curation, D.W. and F.X.; writing—original draft preparation: D.Z.; writing—review and editing: D.W.; project administration: D.W.; funding acquisition: D.W. All authors have read and agreed to the published version of the manuscript.
The authors declare no conflicts of interest.
This work was supported by the Natural Science Foundation of China (Grant No. 32172300), the Technology Project of Henan Province (Grant No. 242102321128), the National University Student Innovation and Entrepreneurship Training Program (202410480038), and the Central Government Guides the Local Science and Technology Development Special Fund (Nos: Z20231811102) as well as Henan Province University Science and Technology Innovation Talent Project (Grant No. 23HASTIT048).
Ayvaz H, Korkmaz F, Polat H, Ayvaz Z, Tuncel NB. Detection of einkorn flour adulteration in flour and bread samples using computer-based image analysis and near-infrared spectroscopy. Food Control 2021;127:108162. 10.1016/j.foodcont.2021.108162
Ankara U, Boyaci I, Yazar S, Koksel H. Rapid detection of common wheat flour addition to durum wheat flour and pasta using spectroscopic methods and chemometrics. J Cereal Sci 2023;109:103604. 10.1016/j.jcs.2022.103604
Büren V, Stadler M, Lüthy J. Detection of wheat adulteration of spelt flour and products by PCR. Eur Food Res Technol 2001;212:234–9. 10.1007/s002170000230
Caterina M, Bergami R, Scaramagli S, Delogu C, Andreani L, Carnevali P, et al. A digital PCR assay to quantify the percentages of hulled vs. hulless wheat in flours and flour-based products. Biology 2021;10:1138. 10.3390/biology10111138
Carloni E, Amagliani G, Omiccioli E, Ceppetelli V, Mastro MD, Rotundo L, et al. Validation and application of a quantitative real-time PCR assay to detect common wheat adulteration of durum wheat for pasta production. Food Chem 2017;224:86–91. 10.1016/j.foodchem.2016.12.053
Chen J, Zhang Y, Chen C, Zhang Y, Zhou W, Sang Y. Identification and quantification of cassava starch adulteration in different food starches by droplet digital PCR. PLoS ONE 2020;15:e0228624. 10.1371/journal.pone.0228624
Cai C, Hou X, Huang B, He J, Wu X, He Q. LAMP assay coupled CRISPR/LbCas12a system in a single-tube method for visual detection of meat adulteration. Food Control 2024;167:110809. 10.1016/j.foodcont.2024.110809
Cui P, Hu Z, Guo M, Wang Y, Xu D, Yao W, et al. Rapid and duplex detection of sweetpotato and maize components in starch products using Proofman-LMTIA method. Microchem J 2024;204:111082. 10.1016/j.microc.2024.111082
Caballero-Agosto ER, Sierra-Vega NO, Rolon-Ocasio Y, Samuel P, Infante-Castillo R, Fontalvo-Gomez M, et al. Detection and quantification of cornstarch and wheat flour as adulterants in milk powder by near-and mid-infrared spectroscopy coupled with chemometric routines. Food Chem Adv 2024;4:100582. 10.1016/j.focha.2023.100582
Cardoso VGK, Poppi RJ. Cleaner and faster method to detect adulteration in cassava starch using Raman spectroscopy and one-class support vector machine. Food Control 2021;125:107917. 10.1016/j.foodcont.2021.107917
Ding S, Chen GY, Wei YH, Dong J, Du F, Cui X, et al. Sequence-specific and multiplex detection of COVID-19 virus (SARS-CoV-2) using proofreading enzyme-mediated probe cleavage coupled with isothermal amplification. Biosens Bioelectron 2021;178:113041. 10.1016/j.bios.2021.113041
He H, Chen Y, Li G, Wang Y, Ou X, Guo J. Hyperspectral imaging combined with chemometrics for rapid detection of talcum powder adulterated in wheat flour. Food Control 2023;144, 109378. 10.1016/j.foodcont.2022.109378
Girolamo AD, Arroyo MC, Cervellieri S, Cortese M, Lippolis V. Detection of durum wheat pasta adulteration with common wheat by infrared spectroscopy and chemometrics: A case study. Lebenson Wiss Technol–Food Sci Technol 2020;127:109368. 10.1016/j.lwt.2020.109368
Grote U, Fasse A, Nguyen T, Erenstein O. Food security and the dynamics of wheat and maize value chains in Africa and Asia. Front Sustain Food Syst 2021;4:617009. 10.3389/fsufs.2020.617009
Glökler J, Lim TS, Ida J, Frohme M. Isothermal amplifications–A comprehensive review on current methods. Crit Rev BiochemMol Biol 2021;56:543–86. 10.1080/10409238.2021.1937927
Gu M, Xiao F, Wang B, Zhang Y, Ding C, Zhang G, et al. Study on detection of soybean components in edible oil with ladder-shape melting temperature isothermal amplification (LMTIA) assay. Anal Methods 2023;15:581–6. 10.1039/D2AY01719A
Guo X, Zhang P, Yue Y. Global wheat planting suitability under the 1.5°C and 2°C warming targets. Front Plant Sci 2024;15:1410388. 10.3389/fpls.2024.1410388
Hazard B, Trafford K, Lovegrove A, Uauy C, Shewry P. Strategies to improve wheat for human health. Nat Food 2020;1:475–80. 10.1038/s43016-020-0134-6
Kaldeli A, Zakidou P, Paraskevopoulou A. Volatilomics as a tool to ascertain food adulteration, authenticity, and origin. Compr Rev Food SciFood Saf 2024;23:13387. 10.1111/1541-4337.13387
Liu H, Wadood S, Xia Y, Liu Y, Gan RY. Wheat authentication: An overview on different techniques andchemometric methods. Crit Rev Food Sci Nutr 2023;63:33–56. 10.1080/10408398.2021.1942783
Luo X, Yang Y, Lin X, Xiao J. Deciphering spike architecture formation towards yield improvement in wheat. J Genet Genom 2023;50:835–45. 10.1016/j.jgg.2023.02.015
Liu J, Wang Y, Li T, Huang K, Song C, Cui P, et al. Dual detection of Bupleurum scorzonerifolium Willd and Bupleurum chinense DC using proofman-LMTIA method. ChemBiol Technol Agric 2024;11:104. 10.1186/s40538-024-00637-2
Murakami T, Sumaoka J, Komiyama M. Sensitive isothermal detection of nucleic acid sequence by primer generation-rolling circle amplification. Nucleic Acids Res 2009;37:e19. 10.1093/nar/gkn1014
Marquez C, Lopez M, Ruisánchez I, Callao P. FTRaman and NIR spectroscopy data fusion strategy for multivariate qualitative analysis of food fraud. Talanta 2016;16180–6. 10.1016/j.talanta.2016.08.003
Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28:e63. 10.1093/nar/28.12.e63
Ndlovu PF, Magwaza LS, Tesfay SZ, Mphahlele RR. Vis-NIR spectroscopic and chemometric models for detecting contamination of premium green banana flour with wheat by quantifying resistant starch content. J Food Composit Anal 2021;102:104035. 10.1016/j.jfca.2021.104035
Pastor K, Acanski M, Vujic D, Kojic P. A rapid dicrimination of wheat, walnut and hazelnut flour samples using chemometric algorithms on GC/MS data. J Food Meas Charact 2019;13:2961–9. 10.1007/s11694-019-00216-2
Peter K, Richard B, Simon J. Wheat area expansion into northern higher latitudes and global food security. Agric Ecosyst Environ 2023;351:108499. 10.1016/j.agee.2023.108499
Schulze C, Geuthner AC, Mäde D. Development and validation of a method for quantification of common wheat, durum wheat, rye and barley by droplet digital PCR. Eur Food Res Technol 2021;247:2267–83. 10.1007/s00217-021-03786-y
Wang D G, Wang Y, Zhang M, Zhang Y, Sun J, Song C, et al. Ladder-shape melting temperature isothermal amplification of nucleic acids. Biotechniques 2021;71:358–69. 10.2144/btn-2020-0173
Wang Y, Wang BR, Wang DG. Detection of chicken adulteration in beef via ladder-shape melting temperature isothermal amplification (LMTIA) assay. Biotechnol Biotechnol Equip 2022;36:339345. 10.1080/13102818.2022.2081514
Wang YZ, Wang B, Wang D. Detection of pork adulteration in beef with ladder-shape melting temperature isothermal amplification (LMTIA) assay. CyTA–J Food 2022;20:244–50. 10.1080/19476337.2022.2129791
Wang YZ, Wang BR, Xu DD, Zhang M, Zhang XH, Wang DG. Development of a ladder-shape melting temperature isothermal amplification (LMTIA) assay for detection of African swine fever virus (ASFV). J Vet Sci 2022;23:e51. 10.4142/jvs.22001
Xu G, Hu L, Zhong H, Wang H, Yusa SI, Weiss TC, et al. Cross priming amplification: Mechanism and optimization for isothermal DNA amplification. Sci Rep 2012;2:246. 10.1038/srep00246
Yao W, Xu D, Zhou D, Liu J, Zhang X, Wang Y, et al. Detection of the thaumatin-like protein gene from Brassica rapa var. oleifera in honey with the Proofman-LMTIA method. CyTA–J Food 2024;22. 10.1080/19476337.2024.2351912
Zhou J, Chen X, JIN M. Adulteration identification of wheat flour in chestnut flour based on differences in mycotoxin contamination by liquid chromatography-tandem mass spectrometry. Chin J Chromatogr 2022;40:303–12. 10.3724/SP.J.1123.2021.10021
Zhang Y, Wang Y, Ouyang X, Wang D, Xiao F, Sun J. Development of a ladder-shape melting temperature isothermal amplification (LMTIA) assay for the identification of cassava component in sweet potato starch noodles. Molecules 2022;27:3414. 10.3390/molecules27113414
Zhang X, Li Z, Zhang Y, Xu D, Zhang L, Xiao F, et al. Rapid discrimination of Panax quinquefolium and Panax ginseng using the Proofman-Duplex-LMTIA technique. Molecules 2023;28:6872. 10.3390/molecules28196872